Virus:Article Title: Replication-Coupled DNA-Protein Crosslink Repair by SPRTN and the Proteasome in Xenopus Egg Extracts
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-Rev1-N Budzowska et al., 2015 N/A Rabbit polyclonal anti-Rev1-C Budzowska et al., 2015 N/A Rabbit polyclonal anti-Orc2 Fang and Newport, 1993 N/A Rabbit polyclonal anti-Cdc45 Mimura and Takisawa, 1998 N/A Rtel1 Sparks et al., 2018 N/A Sld5 Dewar et al., 2017 N/A Rabbit polyclonal anti-Psma1 New England Peptides 3514 Rabbit polyclonal anti-Psma3 New England Peptides 3516 Rabbit polyclonal anti-Sprtn New England Peptides 3703 Rabbit polyclonal anti-Traip New England Peptides 3472 Rabbit polyclonal anti-MCM6 New England Peptides 2926 Rabbit polyclonal anti-Sprtn-N Pocono Rabbit Farm and Laboratory Rabbit # 31053 Rabbit polyclonal anti-M.HpaII Pocono Rabbit Farm and Laboratory Rabbit # 31495 and 31496 Rabbit polyclonal anti-H3 Cell Signaling Cat# 9715S; RRID:AB_331563 Bacterial and Virus Strains E. coli T7 express New England Biolabs C2566H E. coli Rosetta 2 (DE3) pLysS Novagen 71-401-3 Chemicals, Peptides, and Recombinant Proteins Geminin McGarry and Kirschner, 1998 N/A LacI-biotin Duxin et al., 2014 N/A M.HpaII Duxin et al., 2014 N/A xlSPRTN-WT This study N/A xlSPRTN-EQ This study N/A xlSPRTN-SHPx This study N/A xlSPRTN-PIPx This study N/A xlSPRTN-UBZx This study N/A xlSPRTN-1-435 This study N/A xlTRAIP-WT This study N/A xlTRAIP-R18C This study N/A UbVS Boston Biochem U-202 Human Recombinant Ubiquitin Boston Biochem U-100H Human Recombinant FLAG-Ubiquitin Boston Biochem U-120 dnUBC9 Azuma et al., 2003 N/A Human chorionic ganotropin Sigma CG10-10VL MG262 Boston Biochem I-120 Alpha-32P-deoxyadenosinetriphosphate Perkin Elmer BLU512H250UC Gamma-32P-adenosinetriphosphate Perkin Elmer BLU502A100UC Proteinase K, recombinant Roche 3115879001 Aphidicolin Sigma A0781-1MG Ara-cytidine-50triphosphate Jena Bioscience NU-1170S Exonuclease I New England Bioscience M0293S Protein A Sepharose Fast Flow GE Health Care 17-1279-01 (Continued on next page) Molecular Cell 73, 574–588.e1–e7, February 7, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNase A Thermo Fisher EN0531 Gel Loading Dye II Invitrogen AM8547 EDTA-free Complete protease inhibitor cocktail Roche 11873580001 Anti-FLAG M2 affinity resin Sigma A2220-5ML 3xFLAG peptide Sigma F4766-4MG Streaptavidin-coupled magnetic beads M-280 Invitrogen 11205D Benzonase Novagen 70746-3 FLAG M2 magnetic beads Sigma M8823-1ML His-tag Dynabeads Thermo Fisher Scientific 10103D LysC Life Technologies 90051 Trypsin Life Technologies 90305 AluI Methyltransferase New England BioLabs M0220S Critical Commercial Assays UbiCREST Boston Biochem K-400 Reductive Alkylation Kit Hampton Research HR2-434 Quickchange II mutagenesis kit Aglient 200523 Thermo Sequenase Cycle Sequencing kit USB 785001KT Bac to Bac Expression System Thermo Fisher Scientific 10359016 Deposited Data ProteomeXchange This study PXD008831 Experimental Models: Cell Lines Sf9 Insect cells Thermo Fosher Scientific B82501 Experimental Models: Organisms/Strains Xenopus laevis (females) Nasco LM0053MX Xenopus laevis (males) Nasco LM00715MX Oligonucleotides JLS2: GGGAGCTGAATGCCGCGCGAATAATGGTTTCTTAGACGT This study N/A
Recombinant:Article Title: Replication-Coupled DNA-Protein Crosslink Repair by SPRTN and the Proteasome in Xenopus Egg Extracts
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-Rev1-N Budzowska et al., 2015 N/A Rabbit polyclonal anti-Rev1-C Budzowska et al., 2015 N/A Rabbit polyclonal anti-Orc2 Fang and Newport, 1993 N/A Rabbit polyclonal anti-Cdc45 Mimura and Takisawa, 1998 N/A Rtel1 Sparks et al., 2018 N/A Sld5 Dewar et al., 2017 N/A Rabbit polyclonal anti-Psma1 New England Peptides 3514 Rabbit polyclonal anti-Psma3 New England Peptides 3516 Rabbit polyclonal anti-Sprtn New England Peptides 3703 Rabbit polyclonal anti-Traip New England Peptides 3472 Rabbit polyclonal anti-MCM6 New England Peptides 2926 Rabbit polyclonal anti-Sprtn-N Pocono Rabbit Farm and Laboratory Rabbit # 31053 Rabbit polyclonal anti-M.HpaII Pocono Rabbit Farm and Laboratory Rabbit # 31495 and 31496 Rabbit polyclonal anti-H3 Cell Signaling Cat# 9715S; RRID:AB_331563 Bacterial and Virus Strains E. coli T7 express New England Biolabs C2566H E. coli Rosetta 2 (DE3) pLysS Novagen 71-401-3 Chemicals, Peptides, and Recombinant Proteins Geminin McGarry and Kirschner, 1998 N/A LacI-biotin Duxin et al., 2014 N/A M.HpaII Duxin et al., 2014 N/A xlSPRTN-WT This study N/A xlSPRTN-EQ This study N/A xlSPRTN-SHPx This study N/A xlSPRTN-PIPx This study N/A xlSPRTN-UBZx This study N/A xlSPRTN-1-435 This study N/A xlTRAIP-WT This study N/A xlTRAIP-R18C This study N/A UbVS Boston Biochem U-202 Human Recombinant Ubiquitin Boston Biochem U-100H Human Recombinant FLAG-Ubiquitin Boston Biochem U-120 dnUBC9 Azuma et al., 2003 N/A Human chorionic ganotropin Sigma CG10-10VL MG262 Boston Biochem I-120 Alpha-32P-deoxyadenosinetriphosphate Perkin Elmer BLU512H250UC Gamma-32P-adenosinetriphosphate Perkin Elmer BLU502A100UC Proteinase K, recombinant Roche 3115879001 Aphidicolin Sigma A0781-1MG Ara-cytidine-50triphosphate Jena Bioscience NU-1170S Exonuclease I New England Bioscience M0293S Protein A Sepharose Fast Flow GE Health Care 17-1279-01 (Continued on next page) Molecular Cell 73, 574–588.e1–e7, February 7, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNase A Thermo Fisher EN0531 Gel Loading Dye II Invitrogen AM8547 EDTA-free Complete protease inhibitor cocktail Roche 11873580001 Anti-FLAG M2 affinity resin Sigma A2220-5ML 3xFLAG peptide Sigma F4766-4MG Streaptavidin-coupled magnetic beads M-280 Invitrogen 11205D Benzonase Novagen 70746-3 FLAG M2 magnetic beads Sigma M8823-1ML His-tag Dynabeads Thermo Fisher Scientific 10103D LysC Life Technologies 90051 Trypsin Life Technologies 90305 AluI Methyltransferase New England BioLabs M0220S Critical Commercial Assays UbiCREST Boston Biochem K-400 Reductive Alkylation Kit Hampton Research HR2-434 Quickchange II mutagenesis kit Aglient 200523 Thermo Sequenase Cycle Sequencing kit USB 785001KT Bac to Bac Expression System Thermo Fisher Scientific 10359016 Deposited Data ProteomeXchange This study PXD008831 Experimental Models: Cell Lines Sf9 Insect cells Thermo Fosher Scientific B82501 Experimental Models: Organisms/Strains Xenopus laevis (females) Nasco LM0053MX Xenopus laevis (males) Nasco LM00715MX Oligonucleotides JLS2: GGGAGCTGAATGCCGCGCGAATAATGGTTTCTTAGACGT This study N/A
Ubiquitin Proteomics:Article Title: Replication-Coupled DNA-Protein Crosslink Repair by SPRTN and the Proteasome in Xenopus Egg Extracts
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-Rev1-N Budzowska et al., 2015 N/A Rabbit polyclonal anti-Rev1-C Budzowska et al., 2015 N/A Rabbit polyclonal anti-Orc2 Fang and Newport, 1993 N/A Rabbit polyclonal anti-Cdc45 Mimura and Takisawa, 1998 N/A Rtel1 Sparks et al., 2018 N/A Sld5 Dewar et al., 2017 N/A Rabbit polyclonal anti-Psma1 New England Peptides 3514 Rabbit polyclonal anti-Psma3 New England Peptides 3516 Rabbit polyclonal anti-Sprtn New England Peptides 3703 Rabbit polyclonal anti-Traip New England Peptides 3472 Rabbit polyclonal anti-MCM6 New England Peptides 2926 Rabbit polyclonal anti-Sprtn-N Pocono Rabbit Farm and Laboratory Rabbit # 31053 Rabbit polyclonal anti-M.HpaII Pocono Rabbit Farm and Laboratory Rabbit # 31495 and 31496 Rabbit polyclonal anti-H3 Cell Signaling Cat# 9715S; RRID:AB_331563 Bacterial and Virus Strains E. coli T7 express New England Biolabs C2566H E. coli Rosetta 2 (DE3) pLysS Novagen 71-401-3 Chemicals, Peptides, and Recombinant Proteins Geminin McGarry and Kirschner, 1998 N/A LacI-biotin Duxin et al., 2014 N/A M.HpaII Duxin et al., 2014 N/A xlSPRTN-WT This study N/A xlSPRTN-EQ This study N/A xlSPRTN-SHPx This study N/A xlSPRTN-PIPx This study N/A xlSPRTN-UBZx This study N/A xlSPRTN-1-435 This study N/A xlTRAIP-WT This study N/A xlTRAIP-R18C This study N/A UbVS Boston Biochem U-202 Human Recombinant Ubiquitin Boston Biochem U-100H Human Recombinant FLAG-Ubiquitin Boston Biochem U-120 dnUBC9 Azuma et al., 2003 N/A Human chorionic ganotropin Sigma CG10-10VL MG262 Boston Biochem I-120 Alpha-32P-deoxyadenosinetriphosphate Perkin Elmer BLU512H250UC Gamma-32P-adenosinetriphosphate Perkin Elmer BLU502A100UC Proteinase K, recombinant Roche 3115879001 Aphidicolin Sigma A0781-1MG Ara-cytidine-50triphosphate Jena Bioscience NU-1170S Exonuclease I New England Bioscience M0293S Protein A Sepharose Fast Flow GE Health Care 17-1279-01 (Continued on next page) Molecular Cell 73, 574–588.e1–e7, February 7, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNase A Thermo Fisher EN0531 Gel Loading Dye II Invitrogen AM8547 EDTA-free Complete protease inhibitor cocktail Roche 11873580001 Anti-FLAG M2 affinity resin Sigma A2220-5ML 3xFLAG peptide Sigma F4766-4MG Streaptavidin-coupled magnetic beads M-280 Invitrogen 11205D Benzonase Novagen 70746-3 FLAG M2 magnetic beads Sigma M8823-1ML His-tag Dynabeads Thermo Fisher Scientific 10103D LysC Life Technologies 90051 Trypsin Life Technologies 90305 AluI Methyltransferase New England BioLabs M0220S Critical Commercial Assays UbiCREST Boston Biochem K-400 Reductive Alkylation Kit Hampton Research HR2-434 Quickchange II mutagenesis kit Aglient 200523 Thermo Sequenase Cycle Sequencing kit USB 785001KT Bac to Bac Expression System Thermo Fisher Scientific 10359016 Deposited Data ProteomeXchange This study PXD008831 Experimental Models: Cell Lines Sf9 Insect cells Thermo Fosher Scientific B82501 Experimental Models: Organisms/Strains Xenopus laevis (females) Nasco LM0053MX Xenopus laevis (males) Nasco LM00715MX Oligonucleotides JLS2: GGGAGCTGAATGCCGCGCGAATAATGGTTTCTTAGACGT This study N/A
|
Biosynth Carbosynth is a verified supplier 
Biosynth Carbosynth manufactures this product 